Categorias
Sem categoria

WinTeste de coronavírus – como funciona ?, Pesquisa, Departamento de Bioquímica, Universidade de Otago, Nova Zelândia

https://www.otago.ac.nz/biochemistry/research/otago736925.html

Teste de coronavírus – como funciona ?, Pesquisa, Departamento de Bioquímica, Universidade de Otago, Nova Zelândia


Na Nova Zelândia, atualmente usamos um teste de ‘PCR’ para descobrir se alguém está infectado com o novo coronavírus, SARS-CoV-2, que causa a doença chamada Covid-19. O teste de PCR é tão preciso que pode dizer a diferença entre os sete coronavírus que são conhecidos por causar doenças em humanos.

Este vírus: causa esta doença:
SARS-CoV SARS
SARS-CoV-2 Covid-19
MERS-CoV MERS
HCoV-OC43 Gripe comum
HCoV-HKU1 Gripe comum
HCoV-229E Gripe comum
HCoV-NL63 Gripe comum

O teste de PCR procura o material genético do vírus em uma amostra retirada do nariz ou da garganta de uma pessoa. Envolve fazer muitas cópias de um fragmento do material genético do vírus para que possamos ver se ele existe ou não.
O PCR também é uma das técnicas mais importantes que usamos em nossas pesquisas no Departamento de Bioquímica de Otago .

Mas como isso realmente funciona?

Aqui explicamos o que você deve fazer para descobrir se alguém tem o vírus ou não.1) Faça um cotoneteO que está acontecendo com aquelas pontas compridas no nariz das pessoas?trabalhador de saúde com swab_650

Um profissional de saúde prestes a fazer um teste de coronavírus em alguém.

Para descobrir se uma pessoa tem coronavírus, um profissional de saúde usa um cotonete com uma haste longa para raspar suavemente as costas da nasofaringe dessa pessoa. A nasofaringe é a parte superior da garganta, logo atrás do nariz. Não muito confortável!É aqui que está a sua nasofaringe:Desenho anatômico de uma cabeça em corte transversal, com a nasofaringe marcada com uma seta.

Imagem de “Anatomia humana, incluindo estrutura e desenvolvimento e considerações práticas” (1911) em http://www.flickr.com

Depois de raspar a nasofaringe, a ponta do swab terá algumas células e muco da pessoa, bem como bactérias ou vírus que estavam lá.O swab é rapidamente colocado em um tubo contendo uma mistura de proteínas e antibióticos que mantém qualquer vírus coletado seguro, então o tubo é selado e enviado para um laboratório de testes.Você pode ver como um swab é obtido neste vídeo feito pela empresa de educação médica AMBOSS.

Problemas com esfregaço

Normalmente, se alguém está infectado com o vírus e apresenta sintomas, o swab deve ser capaz de coletar partículas de vírus da nasofaringe.No entanto, às vezes o vírus pode estar se multiplicando em lugares distantes de onde está o swab, ou ainda não há vírus suficiente por perto para o swab ser coletado. Portanto, um teste negativo pode significar que você não tem coronavírus, ou que você tem coronavírus e ele ainda não é detectável, ou que a parte errada foi esfregada.

2) Envie a amostra de zaragatoa para um laboratório

Esperançosamente, o correio é rápido!

3) Retire o material genético de RNA e limpe-o

Com o que estamos lidando: O coronavírus é composto de duas partes principais: uma membrana oleosa ao redor do lado de fora, cravejada com proteínas que se projetam da superfície, e material genético chamado RNA no lado de dentro, com mais proteínas firmemente envolvidas em torno dele.Aqui está o desenho de uma partícula de coronavírus cortada ao meio para que você possa ver o interior. As proteínas que se projetam para fora da membrana externa são desenhadas em rosa. Dentro você pode ver o RNA fino e ondulado envolto em proteínas roxas.coronavirus_650

Ilustração de David S. Goodsell, RCSB Protein Data Bank .

Para fazer o teste para verificar o coronavírus, temos que quebrar as partículas do vírus para retirar o material genético. Também precisamos nos livrar de tudo o mais na amostra que pode impedir o funcionamento do teste.A amostra de esfregaço terá muitas coisas nela, incluindo muco e células humanas, bem como vírus. As células humanas também são constituídas por proteínas, membrana, DNA e RNA. Isso significa que precisaremos nos livrar das partes do vírus que não precisamos para o teste (proteínas e membrana oleosa) e tudo o mais na amostra – as proteínas, as membranas oleosas e o DNA do muco e das células humanas.Então … divida as moléculas que não queremos …Nós quebramos as partículas do vírus usando alguns produtos químicos – um detergente e algo chamado sal caotrópico.quebrar vírus_650

Dividir o vírus em pedaços libera seu RNA (a linha irregular em vermelho).

O detergente ajuda a quebrar as membranas das células e vírus, que são compostos por moléculas oleosas.O sal caotrópico tem várias funções. Ele desnatura, ou desvenda, as muitas proteínas diferentes na amostra, impedindo-as de funcionar, e ajuda a separar o RNA de qualquer proteína envolvida nele.Cortamos as proteínas da amostra em pedaços usando uma enzima chamada protease e cortamos o DNA da amostra em pedaços usando uma enzima chamada DNase.Quebrar moléculas_570… Então livre-se de tudo, exceto do RNA. Agora temos um tubo com muitos tipos diferentes de moléculas fragmentadas, misturadas com RNA. Precisamos nos livrar de tudo, exceto do RNA. Para garantir que mantemos o RNA e não o removemos acidentalmente, adicionamos pequenos grânulos magnéticos de sílica (vidro). O RNA adere aos grânulos de sílica, auxiliado pelos sais caotrópicos. Em seguida, colocamos um ímã na parte externa do tubo. As contas (e, portanto, o RNA) grudam na parede interna do tubo, presas lá pelo ímã do lado de fora.Com o ímã segurando as contas e o RNA no lugar, você pode facilmente lavar todos os pedaços restantes de moléculas indesejadas sem perder o RNA. Adicionar líquido com um pouco mais de sal caotrópico ajudará a fazer isso, então podemos lavar o sal usando um pouco de álcool. Assim que o RNA estiver limpo, podemos retirá-lo das esferas magnéticas de sílica simplesmente lavando-as com água. Quando o RNA está na água, e não mais nas contas, podemos nos livrar das contas usando o ímã novamente. Este gif mostra as etapas que usamos para limpar o RNA:limpar RNA com legendas

4) Certifique-se de que o teste detectará apenas o novo coronavírusO RNA restante em sua amostra será uma mistura de RNA humano e RNA de qualquer bactéria ou vírus na nasofaringe da pessoa que foi esfregada.Para ter certeza de que detectaremos apenas o RNA do coronavírus, e não o DNA ou RNA de qualquer outro organismo, precisamos encontrar um pouco da sequência de RNA do coronavírus que é exclusiva do coronavírus e não é compartilhada por nenhum outro ser vivo. O RNA do novo coronavírus foi sequenciado pelos cientistas no início do surto. Existem quase 30.000 bases (letras) no genoma do coronavírus, contendo as instruções para fazer 29 proteínas diferentes. Aqui está um diagrama desse genoma:SARS-CoV-2 genome_650 Precisamos fazer dois pedaços curtos de DNA (‘primers’) que só se fixarão em algum lugar da sequência do genoma.Os cientistas escolheram dois pedaços curtos da sequência no gene E, de 22 e 26 bases de comprimento, para o teste de PCR. A proteína E (envelope) codificada por este gene ajuda a formar a membrana oleosa do vírus.Os cientistas criaram primers de DNA que se prendem apenas a esses pedaços do gene E e a nenhum outro lugar.(A propósito, DNA e RNA se unem, se tiverem as sequências corretas.)
Aqui está a sequência de RNA do gene E (o RNA é composto pelas bases G, C, A e U ):

AUGUACUCAUUCGUUUCGGAAGAGACAGGUACGUUAAUAGUUAAUAGCGUACUUCUUUUUCUUGCUUUCGUGGUAUUCUU
GCUAGUUACACUAGCCAUCCUUACUGCGCUUCGAUUGUGUGCGUACUGCUGCAAUAUUGUUAACGUGAGUCUUGUAAAAC
CUUCUUUUUACGUUUACUCUCGUGUUAAAAAUCUGAAUUCUUCUAGAGUUCCUGAUCUUCUGGUCUAAACGAACUAAAUA
UUAUAUUAGUUUUUCUGUUUGGAACUUUAAUUUUAGCC
E aqui estão as sequências dos dois primers de DNA usados no teste (o DNA é feito de bases G, C, A e T ):

Primer direto: ACAGGTACGTTAATAGTTAATAGCGT
Primer reverso: ATATTGCAGCAGTACGCACACA

Os primers irão apenas aderir ao gene E nas partes sublinhadas aqui:AUGUACUCAUUCGUUUCGGAAGAG ACAGGUACGUUAAUAGUUAAUAGCGU ACUUCUUUUUCUUGCUUUCGUGGUAUUCUU
GCUAGUUACACUAGCCAUCCUUACUGCGCUUCGAU UGUGUGCGUACUGCUGCAAUAU UGUUAACGUGAGUCUUGUAAAAC
CUUCUUUUUACGUUUACUCUCGUGUUAAAAAUCUGAAUUCUUCUAGAGUUCCUGAUCUUCUGGUCUAAACGAACUAAAUA
UUAUAUUAGUUUUUCUGUUUGGAACUUUAAUUUUAGCC É assim que o teste detectará apenas o RNA do coronavírus, e não o RNA de qualquer outra coisa.

5) Se o vírus estiver aí, faça DNA!Tempo para algum RT-PCRPara detectar qualquer RNA de coronavírus presente, precisamos fazer muitas e muitas cópias dele, mas não podemos facilmente fazer muitas cópias de RNA diretamente.
Portanto, primeiro temos que fazer uma cópia do DNA do RNA. Isso é chamado de transcrição reversa (RT), que fazemos usando uma enzima chamada transcriptase reversa.

Assim que tivermos a cópia do DNA, podemos fazer várias cópias usando a reação em cadeia da polimerase (PCR) e uma enzima chamada DNA polimerase.

Usamos os primers do gene E em ambas as etapas para que apenas o RNA do vírus seja copiado e nada mais.Este vídeo mostra como funciona o RT-PCR.
Como podemos saber se o RNA do vírus foi copiado com sucesso?
Os laboratórios de teste fazem 45 “ciclos” de PCR em uma amostra de teste Covid-19, que leva pouco mais de meia hora. Após esse tempo, uma única molécula de RNA do SARS-CoV-2 terá se tornado 17 milhões de moléculas de DNA idênticas. Eles são tão pequenos que você AINDA não consegue vê-los com os olhos.

Para ver quanto DNA existe e descobrir se o teste é positivo, a mistura de reação de PCR inclui uma etiqueta especial que brilha quando é cortada. A etiqueta adere ao mesmo pedaço de DNA que um dos primers. Quando o DNA é copiado, a etiqueta é arrancada do DNA e picada. A etiqueta descolada e cortada começa a ficar fluorescente (brilhar). Essas tags podem ser ‘vistas’ e medidas por uma máquina que detecta a luz. Quanto mais fluorescência for detectada em uma reação de PCR, mais cópias de DNA serão feitas. Então, quando há muito brilho, você sabe que o RNA do coronavírus estava na amostra de swab e muitas cópias de DNA foram feitas e, portanto, o teste é positivo. Se não houver brilho, não havia nenhum coronavírus na amostra de cotonete, nenhuma cópia do DNA poderia ser feita e o teste é negativo. PCR em tempo real baseado em sonda fluorescente_650. Faça vários testes ao mesmo tempo (Entre nos robôs !!!) Uma parte realmente importante do teste de coronavírus é que podemos realizar muitos testes o mais rápido possível. Nossos laboratórios de teste fazem isso contratando robôs para fazer a preparação do RNA e a PCR de transcrição reversa. Uma pessoa pode processar cerca de 100 amostras manualmente por dia, mas uma máquina robótica, uma vez configurada corretamente, pode realizar até 1000 testes em 24 horas e não é provável que cometa erros.Esta é uma das máquinas de teste de robôs que usamos na Nova Zelândia:robô pantera O que acontece se ficarmos sem kits de teste do exterior?
Nossos amigos vizinhos do Departamento de Microbiologia e Imunologia de Otago ajudaram a colocar esse teste em funcionamento na Nova Zelândia. Eles o projetaram para funcionar com enzimas e outros reagentes que podemos importar do exterior.

Mas o que acontece se houver escassez de alguns desses reagentes no exterior e não pudermos importá-los por um tempo?
Profissionais de saúde, cientistas e a mídia destacaram isso como um problema sobre o qual precisamos pensar. (Leia o artigo sobre RNZ: Covid-19: kits de teste limitados têm cientistas em busca de alternativas genéricas .)

Podemos fazer partes importantes do teste aqui na Nova Zelândia, se necessário.É aqui que as habilidades e os equipamentos de instituições de pesquisa como a Otago Biochemistry podem ajudar.fazendo a transcriptase reversa_650

Sam Jamieson purifica a enzima transcriptase reversa no laboratório Mace.

Na Otago Bioquímica, já praticamos a fabricação de enzimas por precaução. O grupo de pesquisa do professor associado Peter Mace já fez a enzima transcriptase reversa.

Eles colocaram o gene que codifica a enzima em algumas bactérias, fizeram com que as bactérias produzissem a enzima e, em seguida, extraíram a enzima das bactérias.Os cientistas costumam fazer proteínas dessa maneira, para que possamos estudá-las e descobrir como funcionam.gel_650 de purificação de transcriptase reversa

Uma foto de um gel que mostra a enzima em diferentes estágios durante a purificação. As grandes bolhas à direita são amostras da enzima transcriptase reversa pura.

Há uma quantidade incrível de pesquisas sendo realizadas sobre o novo coronavírus em todo o mundo. Reunimos uma coleção de links para sites úteis que explicam a aparência do vírus, como funciona, como testá-lo, quais tratamentos e vacinas estão sendo desenvolvidos e muito mais em nossa página Informações úteis sobre o novo coronavírus .

Você pode ler e assistir a mais histórias sobre pesquisas na Otago Bioquímica em nossa página de Recursos Escolares .

Contacte-nos com qualquer sugestão para melhorar ou adicionar a esta página em biochemistry@otago.ac.nz .

Deixe um comentário

Preencha os seus dados abaixo ou clique em um ícone para log in:

Logotipo do WordPress.com

Você está comentando utilizando sua conta WordPress.com. Sair /  Alterar )

Foto do Google

Você está comentando utilizando sua conta Google. Sair /  Alterar )

Imagem do Twitter

Você está comentando utilizando sua conta Twitter. Sair /  Alterar )

Foto do Facebook

Você está comentando utilizando sua conta Facebook. Sair /  Alterar )

Conectando a %s